This is an old revision of the document!
Genetics of SARS-CoV-2
The genetics of SARS-CoV-2 has been controversial due to the debates over gain-of-function research and the origins story of the virus that led to COVID-19 pandemic policies.
Genetic RNA Structure
Codons
Early analysis of the genetics of SARS-CoV-2 which included examination of relative synonymous codon usage (RSCU) showed greatest similarity of genetic information with bat CoVs, but had most similar codon bias usage with snakes.1)
- Analysis of SARS-CoV-2 synonymous codon usage evolution throughout the COVID-19 pandemic2)
Gain-of-Function
Specific Sequences
TATCAGACTCAGACTAATTCTCCTCGGCGGGCACGT
- Gain-of-Function Smashing Success: The Key Sequence Inserted in the SARS-CoV-2 Virus Added at Least *FOUR* Distinct Functions. Coincidence?3)
Data Controversies
1)
January 22, 2020 | Wei Ji et al | Journal of Medical Virology | Cross-species transmission of the newly identified coronavirus 2019-nCoV | https://doi.org/10.1002/jmv.25682
2)
December 17, 2021 | Ezequiel Mogro et al | preprint | Analysis of SARS-CoV-2 synonymous codon usage evolution throughout the COVID-19 pandemic | https://doi.org/10.1101/2021.12.17.472912