This is an old revision of the document!


Genetics of SARS-CoV-2

The genetics of SARS-CoV-2 has been controversial due to the debates over gain-of-function research and the origins story of the virus that led to COVID-19 pandemic policies.

Genetic RNA Structure

Codons

  • Analysis of SARS-CoV-2 synonymous codon usage evolution throughout the COVID-19 pandemic1)

Gain-of-Function

Specific Sequences

TATCAGACTCAGACTAATTCTCCTCGGCGGGCACGT

  • Gain-of-Function Smashing Success: The Key Sequence Inserted in the SARS-CoV-2 Virus Added at Least *FOUR* Distinct Functions. Coincidence?2)

Data Controversies

1)
December 17, 2021 | Ezequiel Mogro et al | preprint | Analysis of SARS-CoV-2 synonymous codon usage evolution throughout the COVID-19 pandemic | https://doi.org/10.1101/2021.12.17.472912
Back to top