Differences

This shows you the differences between two versions of the page.

--- sars-cov-2:genetics_of_sars-cov-2 [2022/04/14 10:32]
mathew
+++ sars-cov-2:genetics_of_sars-cov-2 [2022/09/19 05:19] (current)
pamela [HIV Components]
@@ Line 1: / Line 1: @@
 ====== Genetics of SARS-CoV-2 ======
-The **genetics of SARS-CoV-2** has been controversial due to the debates over [[:gain-of-function]] research and the [[SARS-CoV-2:origins]] story of the virus that led to [[:COVID-19 pandemic]] policies.
+The **genetics of [[:SARS-CoV-2]]** has been controversial due to the debates over [[:gain-of-function]] research and the [[SARS-CoV-2:origins]] story of the virus that led to [[:COVID-19 pandemic]] policies.
 ===== Genetic RNA Structure =====
 ==== Codons ====
+Early analysis of the genetics of SARS-CoV-2 which included examination of relative synonymous codon usage (RSCU) showed greatest similarity of genetic information with bat CoVs, but had most similar codon bias usage with snakes.((January 22, 2020 | Wei Ji et al | Journal of Medical Virology | Cross-species transmission of the newly identified coronavirus 2019-nCoV | [[https://onlinelibrary.wiley.com/doi/10.1002/jmv.25682|https://doi.org/10.1002/jmv.25682]]))
   * Analysis of SARS-CoV-2 synonymous codon usage evolution throughout the COVID-19 pandemic((December 17, 2021 | Ezequiel Mogro et al | preprint | Analysis of SARS-CoV-2 synonymous codon usage evolution throughout the COVID-19 pandemic | [[https://www.biorxiv.org/content/10.1101/2021.12.17.472912v1.full|https://doi.org/10.1101/2021.12.17.472912]]))
+==== HIV Components ====
+{{ :sars-cov-2:cd4_hiv_study_1993_.png?400|}}
+*** Oct 29, 1993 ***
+Philos Trans R Soc Lond B Biol Sci. 1993 Oct 29;342(1299):59-66. doi: 10.1098/rstb.1993.0136.
+The role of CD4 in HIV binding and entry
+Q J Sattentau  1 , J P Moore 1 - Centre d'Immunologie de Marseille-Luminy, Marseille, France.
+PMID: 7904348 DOI: 10.1098/rstb.1993.0136
+Abstract - The primary cellular receptor for the human and simian immunodeficiency viruses HIV-1, HIV-2 and SIV is the CD4 antigen (Sattentau et al. 1988; Sattentau & Weiss 1988).
+HIV infection of CD4+ cells is initiated by binding of the virus to the cell surface, via a high-affinity interaction between the first domain of CD4 and the HIV outer envelope [[:glycoprotein]], gp120. The use of a soluble recombinant form of CD4 (sCD4) as a receptor mimic has simplified the analysis of receptor binding and post-binding events which result in virus-cell membrane fusion.
+With cell-line adapted isolates of [[:HIV-1]], sCD4 binding induces conformational changes in gp120, leading to the complete dissociation of gp120 from the transmembrane glycoprotein, [[:gp41]], and exposing cryptic epitopes of gp41. Similar observations have been made with cell-anchored CD4: recruitment of CD4 molecules leads to exposure of cryptic gp41 epitopes at the fusion interface between clusters of CD4 expressing and HIV-infected cells.
+It has therefore been proposed that [[:CD4]] binding induces exposure of fusogenic components of gp41 which mediate virus-cell membrane coalescence, a process termed receptor-mediated activation of fusion. With the related lentiviruses HIV-2 and SIV, the CD4 induced molecular rearrangements in [[:gp120]] are more subtle, implying that there is a spectrum of responses to sCD4 binding. ((https://web.archive.org/web/20201024142650/https://pubmed.ncbi.nlm.nih.gov/7904348/))
+=== Incredible Discoveries - Rixey's homologous elements between HlV/SARS-CoV-2 ===
+{{ ::sars-cov-2_genome_match_2015_studies.png?400|}}
+Charles Rixey, MA MBA @CharlesRixey
+How interesting. The parts of the env trimer for HlV found in the SARS-CoV-2 genome happen to match the epitopes targeted for vx studies since ~2015. They target the CD4 binding site. & DC-SIGN [CD209]. This is what was blocked by Fαuci in Jan 2020
+@GigaohmResist @TyCardon
+Fauci knew what these meant, because his VRC had been working on such candidates since at least 2006.
+He knew that Furin triggers cancer cell growth, and that HlV is enhanced by/enhances amyloid dev.
+The cascade of both would look just like what has shown us
+This is what has become clear to me after reading 400 studies just looking at the homologous elements between HlV/SARS-CoV-2.
+It's the end result of the findings laid out in  It's what they must hide until after the election ((https://web.archive.org/web/20220917230646/https://threadreaderapp.com/thread/1571168157754089479.html))
 ===== Gain-of-Function =====
@@ Line 13: / Line 49: @@
 === TATCAGACTCAGACTAATTCTCCTCGGCGGGCACGT ===
   * Gain-of-Function Smashing Success: The Key Sequence Inserted in the SARS-CoV-2 Virus Added at Least *FOUR* Distinct Functions. Coincidence?((April 5, 2022 | Ashmedai | [[https://ashmedai.substack.com/p/gain-of-function-smashing-success?token=eyJ1c2VyX2lkIjoxNDgwODcyMSwicG9zdF9pZCI6NDk5NDUyNzIsIl8iOiJPMmMyOCIsImlhdCI6MTY0OTIzMjkzNywiZXhwIjoxNjQ5MjM2NTM3LCJpc3MiOiJwdWItNDcxNjY1Iiwic3ViIjoicG9zdC1yZWFjdGlvbiJ9.OwxBcd0x8C1h7uflyxbK_8DB5AqSXUcOaO7er6x37Ck&s=r|Gain-of-Function Smashing Success: The Key Sequence Inserted in the SARS-CoV-2 Virus Added at Least *FOUR* Distinct Functions. Coincidence?]]))
+=== SEB Insert ===
+Researchers found that that a [[:monoclonal antibody]] against SEB inhibits SARS-CoV-2 entry //in vitro//.((September 2, 2021 | Mary Hongying Cheng et al | Structure (journal) | A monoclonal antibody against staphylococcal enterotoxin B superantigen inhibits SARS-CoV-2 entry in vitro | [[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8082696/|doi: 10.1016/j.str.2021.04.005]])) It is interesting to note that the preprint of this paper was uploaded on November 24, 2020, but went unpublished for more than 9 months.
 ===== Data Controversies =====
 https://www.washingtonpost.com/health/coronavirus-origin-nih-gene-sequence-deletion/2021/06/23/186e87d0-d437-11eb-a53a-3b5450fdca7a_story.html